spoIIGA [2018-04-30 08:46:43]

Pro-SigE protease

Locus: BSU15310

Isoelectric point: 8.55

Molecular weight: 34.70 kDa

Protein length: 309 aa

Gene length: 927 bp

Function: maturation of SigE

Product: Pro-SigE protease

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Proteolysis → Proteolysis during sporulation/ germination
• Information processing → Regulation of gene expression → Sigma factors and their control → Control of sigma factors
• Lifestyles → Sporulation → Sporulation/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,603,779 → 1,604,708

The protein

Protein family

• peptidase U4 family (according to Swiss-Prot)

Effectors of protein activity

• SpoIIGA protease activity is stimulated by the interaction with SpoIIR in the intermembrane space between the forespore and the mother cell PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: spoIIGA-sigE-sigG
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigG: sigma factor, PubMed, in SigG regulon
  • SigF: sigma factor, in SigF regulon

  Regulatory mechanism

  • SinR: repression, in SinR regulon
  • Spo0A: activation, PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • spoIIGA: expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • the mRNA half-life is about 2.6 min PubMed

Biological materials

Mutant

• BKE15310 (ΔspoIIGA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATCTGACTCCTTTCTTT, downstream forward: _UP4_TAATGTTCGCAAATGTCCGT
• BKK15310 (ΔspoIIGA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACATCTGACTCCTTTCTTT, downstream forward: _UP4_TAATGTTCGCAAATGTCCGT

References

Loading